About   Help   FAQ
D12Mit36 Primer Detail
Primers
  • Name
    D12Mit36
  • Primer 1 Sequence
    CATCACACCAGGTTTAGAATTTT
  • Primer 2 Sequence
    AGGCACTCTTCTGACCTCCA
  • ID
    MGI:706761
  • Product Size
    119
  • Other IDs
    D12Mit36 (BROAD)
  • Note
    MIT assay: B297
    Additional information: MIT STS Marker Data Files
Genes
D12Mit36 DNA segment, Chr 12, Massachusetts Institute of Technology 36
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Mit36 c larger C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit36 a 96bp SPRET/EiJ
b 104bp CAST/EiJ
c 120bp NON/ShiLt
d 122bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
e 128bp NOD/MrkTac
f 136bp A/J, BALB/cJ, DBA/2J, LP/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D12Mit36 a 136bp A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
b 122bp 129/SvW, AKR/W, C57BL/6W, C57BL/10W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory