About   Help   FAQ
D12Mit34 Primer Detail
Primers
  • Name
    D12Mit34
  • Primer 1 Sequence
    GACCACCAGGGCTATTACACA
  • Primer 2 Sequence
    TGCCAATCTTCACTCATGTACC
  • ID
    MGI:706759
  • Product Size
    171
  • Other IDs
    D12Mit34 (BROAD)
  • Note
    MIT assay: B176
    Additional information: MIT STS Marker Data Files
Genes
D12Mit34 DNA segment, Chr 12, Massachusetts Institute of Technology 34
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Mit34 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit34 a 160bp SPRET/EiJ
b 172bp CAST/EiJ
c 174bp B6.Cg-Lepob/+, C57BL/6J
d 186bp AKR/J, LP/J, NOD/MrkTac
e 188bp A/J, BALB/cJ, C3H/HeJ, DBA/2J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory