D11Mit21 Primer Detail MGI Mouse MGI:706753

D11Mit21 Primer Detail

Name

D11Mit21
Primer 1 Sequence

GAGAGCTCTTTCACACTTGAAGG
Primer 2 Sequence

CAGAAAGGCTCCTACCTCAGG
ID

MGI:706753
Product Size

157
Other IDs

D11Mit21 (BROAD)
Note

MIT assay: A743
Additional information: MIT STS Marker Data Files

D11Mit21

DNA segment, Chr 11, Massachusetts Institute of Technology 21

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit21	a	136bp	AKR/J, DBA/2J
	b	146bp	A/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
	c	154bp	SPRET/EiJ
	d	156bp	B6.Cg-Lep^ob/+, C57BL/6J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D11Mit21	a	156bp	C57BL/6W, C57BL/10W
	b	146bp	A.CA/W, BALB/cW, C3H/W, CBA/W
	c	136bp	129/SvW, AKR/W, BN/aW, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24