D15Mit122 Primer Detail MGI Mouse MGI:706747

D15Mit122 Primer Detail

Name

D15Mit122
Primer 1 Sequence

ACCCAGTGCAGGTGCTCTAT
Primer 2 Sequence

GGAGAATACAAGTTATGCCTTAGACC
ID

MGI:706747
Product Size

145
Other IDs

D15Mit122 (BROAD)
Note

MIT assay: MT1345
Additional information: MIT STS Marker Data Files

DNA segment, Chr 15, Massachusetts Institute of Technology 122

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit122	a	144bp	BALB/cJ, C3H/HeJ
	b	150bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	154bp	SPRET/EiJ
	d	158bp	A/J, AKR/J
	e	179bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D15Mit122	a	158bp	A.CA/W, AKR/W
	b	150bp	129/SvW, BN/aW, C57BL/6W, C57BL/10W, DBA/2W
	c	144bp	BALB/cW, C3H/W, CBA/W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit122	c	smaller	CBA/Kw
	D15Mit122	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24