About   Help   FAQ
D1Mit231 Primer Detail
Primers
  • Name
    D1Mit231
  • Primer 1 Sequence
    ACCCACAATTGCCTGTGG
  • Primer 2 Sequence
    GTCTTTGCAAGCCACCAAAT
  • ID
    MGI:706737
  • Product Size
    267
  • Other IDs
    D1Mit231 (BROAD)
  • Note
    MIT assay: MT1700
    Additional information: MIT STS Marker Data Files
Genes
D1Mit231 DNA segment, Chr 1, Massachusetts Institute of Technology 231
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit231 a 267bp 129X1/Sv
f 219, 267bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit231 a 219bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NON/ShiLt
b 267bp B6.Cg-Lepob/+, C57BL/6J
c 269bp NOD/MrkTac
d 271bp LP/J
e 299bp CAST/EiJ
f 307bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D1Mit231 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory