D1Mit231 Primer Detail MGI Mouse MGI:706737

D1Mit231 Primer Detail

Name

D1Mit231
Primer 1 Sequence

ACCCACAATTGCCTGTGG
Primer 2 Sequence

GTCTTTGCAAGCCACCAAAT
ID

MGI:706737
Product Size

267
Other IDs

D1Mit231 (BROAD)
Note

MIT assay: MT1700
Additional information: MIT STS Marker Data Files

D1Mit231

DNA segment, Chr 1, Massachusetts Institute of Technology 231

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D1Mit231	a	267bp	129X1/Sv
Not Specified	D1Mit231	f	219, 267bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit231	a	219bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NON/ShiLt
	b	267bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	269bp	NOD/MrkTac
	d	271bp	LP/J
	e	299bp	CAST/EiJ
	f	307bp	SPRET/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D1Mit231	c	not given	C58/J
	f	not given	FVB/NJ
	i	smaller	I/LnJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24