About   Help   FAQ
D7Mit228 Primer Detail
Primers
  • Name
    D7Mit228
  • Primer 1 Sequence
    ATTCTTGGCCTTTTCTTGTAACA
  • Primer 2 Sequence
    AAACCTCCACACTGACTTCCA
  • ID
    MGI:706708
  • Product Size
    147
  • Other IDs
    D7Mit228 (BROAD)
  • Note
    MIT assay: MT2285
    Additional information: MIT STS Marker Data Files
Genes
D7Mit228 DNA segment, Chr 7, Massachusetts Institute of Technology 228
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit228 a 133bp LP/J
b 140bp C3H/HeJ
c 142bp A/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
d 144bp AKR/J
e 148bp B6.Cg-Lepob/+, C57BL/6J
f 151bp CAST/EiJ
g 159bp DBA/2J, SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit228 c 234bp CBA/CaOlaHsd
s 231bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory