About   Help   FAQ
D9Mit2 Primer Detail
Primers
  • Name
    D9Mit2
  • Primer 1 Sequence
    GTGGTCTGCCCTCTTCACAT
  • Primer 2 Sequence
    CAAAGCCAGTCCAACTCCAA
  • ID
    MGI:706696
  • Product Size
    174
  • Other IDs
    D9Mit2 (BROAD)
  • Note
    MIT assay: L32
    Additional information: MIT STS Marker Data Files
Genes
D9Mit2 DNA segment, Chr 9, Massachusetts Institute of Technology 2
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D9Mit2 c 182bp C3HeB/FeJLe
f smaller FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D9Mit2 m 190bp MOLF/EiJ
s 175bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit2 a 159bp CAST/EiJ, LP/J, SPRET/EiJ
b 169bp NON/ShiLt
c 174bp AKR/J
d 175bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
e 182bp A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D9Mit2 l smaller LG/J
s larger SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory