About   Help   FAQ
D5Mit233 Primer Detail
Primers
  • Name
    D5Mit233
  • Primer 1 Sequence
    TCCCCTCTGATCTCCTCAGA
  • Primer 2 Sequence
    CCTCCTAGAATACAATTCAATGTGG
  • ID
    MGI:706679
  • Product Size
    147
  • Other IDs
    D5Mit233 (BROAD)
  • Note
    MIT assay: MT2906
    Additional information: MIT STS Marker Data Files
Genes
D5Mit233 DNA segment, Chr 5, Massachusetts Institute of Technology 233
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D5Mit233 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit233 a 134bp SPRET/EiJ
b 147bp B6.Cg-Lepob/+, C57BL/6J, LP/J
c 154bp CAST/EiJ
d 168bp DBA/2J
e 176bp BALB/cJ
f 180bp A/J, AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory