D6Mit124 Primer Detail MGI Mouse MGI:706660

D6Mit124 Primer Detail

Name

D6Mit124
Primer 1 Sequence

TAGTGCCCTCTTCCAATTGG
Primer 2 Sequence

TTTCCTTCAACATAGATGTTTCTCA
ID

MGI:706660
Product Size

190
Other IDs

D6Mit124 (BROAD)
Note

MIT assay: MT168
Additional information: MIT STS Marker Data Files

D6Mit124

DNA segment, Chr 6, Massachusetts Institute of Technology 124

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit124	a	largest	MSM/Ms
		b	smaller	DBA/2, JF1
		c	smallest	C57BL/6

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit124	a	194bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NON/ShiLt
	b	198bp	NOD/MrkTac
	c	200bp	AKR/J, C3H/HeJ, CAST/EiJ, DBA/2J
	d	230bp	SPRET/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24