About   Help   FAQ
D5Mit394 Primer Detail
Primers
  • Name
    D5Mit394
  • Primer 1 Sequence
    TAGATGCTGCCTAACAATTAGTAAGT
  • Primer 2 Sequence
    TGGGAATATTTTTTCAAGTGTCTC
  • ID
    MGI:706627
  • Product Size
    150
  • Other IDs
    D5Mit394 (BROAD)
  • Note
    MIT assay: MTH2652
    Additional information: MIT STS Marker Data Files
Genes
D5Mit394 DNA Segment, Chr 5 Massachusetts Institute of Technology 394
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit394 a 114bp A/J, AKR/J, BALB/cJ, DBA/2J, NOD/MrkTac
b 126bp SPRET/EiJ
c 132bp C3H/HeJ, CAST/EiJ, NON/ShiLt
d 154bp B6.Cg-Lepob/+, C57BL/6J, LP/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D5Mit394 a 154bp 129/SvW, C57BL/6W, C57BL/10W
b 132bp BN/aW, C3H/W, CBA/W
c 114bp A.CA/W, AKR/W, BALB/cW, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory