About   Help   FAQ
D5Mit161 Primer Detail
Primers
  • Name
    D5Mit161
  • Primer 1 Sequence
    CACACGCATAGTCTTGTGGG
  • Primer 2 Sequence
    GCATGTTCAACTGTGCTTTCA
  • ID
    MGI:706617
  • Product Size
    119
  • Other IDs
    D5Mit161 (BROAD)
  • Note
    MIT assay: MT202
    Additional information: MIT STS Marker Data Files
Genes
D5Mit161 DNA segment, Chr 5, Massachusetts Institute of Technology 161
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D5Mit161 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit161 a 120bp SPRET/EiJ
b 122bp B6.Cg-Lepob/+, C57BL/6J
c 126bp A/J, BALB/cJ, LP/J, NON/ShiLt
d 128bp AKR/J, C3H/HeJ
e 140bp DBA/2J
f 142bp CAST/EiJ
g 156bp NOD/MrkTac
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit161 c 211bp CBA/CaOlaHsd
s 118bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory