D5Mit161 Primer Detail MGI Mouse MGI:706617

D5Mit161 Primer Detail

Name

D5Mit161
Primer 1 Sequence

CACACGCATAGTCTTGTGGG
Primer 2 Sequence

GCATGTTCAACTGTGCTTTCA
ID

MGI:706617
Product Size

119
Other IDs

D5Mit161 (BROAD)
Note

MIT assay: MT202
Additional information: MIT STS Marker Data Files

D5Mit161

DNA segment, Chr 5, Massachusetts Institute of Technology 161

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit161	b	smaller	C57BL/6J
	D5Mit161	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit161	a	120bp	SPRET/EiJ
	b	122bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	126bp	A/J, BALB/cJ, LP/J, NON/ShiLt
	d	128bp	AKR/J, C3H/HeJ
	e	140bp	DBA/2J
	f	142bp	CAST/EiJ
	g	156bp	NOD/MrkTac

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit161	c	211bp	CBA/CaOlaHsd
	D5Mit161	s	118bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24