About   Help   FAQ
D5Mit169 Primer Detail
Primers
  • Name
    D5Mit169
  • Primer 1 Sequence
    CCAGGTCTCCAGGGTTGTAA
  • Primer 2 Sequence
    CTCCTGAGGGAACGAGTCAG
  • ID
    MGI:706609
  • Product Size
    113
  • Other IDs
    D5Mit169 (BROAD)
  • Note
    MIT assay: MT1196
    Additional information: MIT STS Marker Data Files
Genes
D5Mit169 DNA segment, Chr 5, Massachusetts Institute of Technology 169
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit169 a 113bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J
b 115bp SPRET/EiJ
c 119bp A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
d 121bp NON/ShiLt
e 129bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit169 c 111bp CBA/CaOlaHsd
s 115bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory