About   Help   FAQ
D10Mit233 Primer Detail
Primers
  • Name
    D10Mit233
  • Primer 1 Sequence
    GTGCTTTATATTGGAGATCATCACA
  • Primer 2 Sequence
    GTCCCGAATTTCACATACATAGC
  • ID
    MGI:706605
  • Product Size
    130
  • Other IDs
    D10Mit233 (BROAD)
  • Note
    MIT assay: MT4945
    Additional information: MIT STS Marker Data Files
Genes
D10Mit233 DNA segment, Chr 10, Massachusetts Institute of Technology 233
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit233 b 0.130kb B10.BR-H2k, C57BL/6
c 0.110kb B10.D2-H2d, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit233 a 110bp 129X1/Sv
f 108, 110bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Mit233 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit233 a 100bp NOD/MrkTac, SPRET/EiJ
b 108bp AKR/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
c 110bp A/J, BALB/cJ
d 116bp CAST/EiJ
e 130bp B6.Cg-Lepob/+, C57BL/6J
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory