About   Help   FAQ
D14Mit11 Primer Detail
Primers
  • Name
    D14Mit11
  • Primer 1 Sequence
    AATATTTTCATGTTTGGAGTCGTG
  • Primer 2 Sequence
    CACTGCAGTGTCAATTTCTACTTT
  • ID
    MGI:706588
  • Product Size
    150
  • Other IDs
    D14Mit11 (BROAD)
  • Note
    MIT assay: A717
    Additional information: MIT STS Marker Data Files
Genes
D14Mit11 DNA segment, Chr 14, Massachusetts Institute of Technology 11
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D14Mit11 a 150bp 129X1/Sv
f 136, 152bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit11 a 12bp BALB/cJ
b 128bp SPRET/EiJ
c 136bp NOD/MrkTac
d 150bp CAST/EiJ
e 152bp A/J, AKR/J, B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
f 158bp C3H/HeJ, DBA/2J, LP/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D14Mit11 c 136bp CBA/CaOlaHsd
s 157bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D14Mit11 a 158bp 129/SvW, DBA/2W
b 152bp A.CA/W, AKR/W, BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
c 148bp BN/aW
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/30/2024
MGI 6.23 		The Jackson Laboratory