D17Mit221 Primer Detail MGI Mouse MGI:706544

D17Mit221 Primer Detail

Name

D17Mit221
Primer 1 Sequence

AACCAGATCATTAACAGTAATAAAGCA
Primer 2 Sequence

TTGTGGCAAAAACAACCAAA
ID

MGI:706544
Product Size

138
Other IDs

D17Mit221 (BROAD)
Note

MIT assay: MT5244
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 221

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D17Mit221	b	larger than f	C57BL/6J
	c	157bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit221	a	135bp	NOD/MrkTac
	b	139bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	143bp	CAST/EiJ
	d	149bp	DBA/2J
	e	153bp	A/J, AKR/J, BALB/cJ, LP/J, NON/ShiLt
	f	157bp	C3H/HeJ, SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23