About   Help   FAQ
D17Mit221 Primer Detail
Primers
  • Name
    D17Mit221
  • Primer 1 Sequence
    AACCAGATCATTAACAGTAATAAAGCA
  • Primer 2 Sequence
    TTGTGGCAAAAACAACCAAA
  • ID
    MGI:706544
  • Product Size
    138
  • Other IDs
    D17Mit221 (BROAD)
  • Note
    MIT assay: MT5244
    Additional information: MIT STS Marker Data Files
Genes
D17Mit221 DNA segment, Chr 17, Massachusetts Institute of Technology 221
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D17Mit221 b larger than f C57BL/6J
c 157bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit221 a 135bp NOD/MrkTac
b 139bp B6.Cg-Lepob/+, C57BL/6J
c 143bp CAST/EiJ
d 149bp DBA/2J
e 153bp A/J, AKR/J, BALB/cJ, LP/J, NON/ShiLt
f 157bp C3H/HeJ, SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory