D17Mit222 Primer Detail MGI Mouse MGI:706543

D17Mit222 Primer Detail

Name

D17Mit222
Primer 1 Sequence

TGGAAGAGGGAACCTCTAGTAGG
Primer 2 Sequence

GAGGGAGATAGAGGAAGGAAGG
ID

MGI:706543
Product Size

125
Other IDs

D17Mit222 (BROAD)
Note

MIT assay: MTH2115
Additional information: MIT STS Marker Data Files

D17Mit222a	DNA segment, Chr 17, Massachusetts Institute of Technology 222a
D17Mit222b	DNA segment, Chr 17, Massachusetts Institute of Technology 222b

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit222a	b	126bp	C57BL/6J
Not Specified	D17Mit222a	s	132bp	129X1/SvJ, BALB/cJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit222a	a	120bp	SPRET/EiJ
	b	126bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	c	128bp	NOD/MrkTac
	d	130bp	A/J, AKR/J, DBA/2J, LP/J
	e	132bp	BALB/cJ
	f	142bp	CAST/EiJ

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24