D3Mit120 Primer Detail MGI Mouse MGI:706448

D3Mit120 Primer Detail

Name

D3Mit120
Primer 1 Sequence

CAGTCCCCAAGACACACATG
Primer 2 Sequence

TACAGGATTGAGGCTAGTTTTCG
ID

MGI:706448
Product Size

149
Note

MIT assay: MMH295

D3Mit120

DNA segment, Chr 3, Massachusetts Institute of Technology 120

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit120	a	132bp	CAST/EiJ
	b	148bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J
	c	160bp	AKR/J, BALB/cJ, C3H/HeJ, NOD/MrkTac, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit120	a	160bp	A.CA/W, AKR/W, BALB/cW, C3H/W, CBA/W, DBA/2W
	D3Mit120	b	148bp	129/SvW, BN/aW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24