About   Help   FAQ
D4Mit229 Primer Detail
Primers
  • Name
    D4Mit229
  • Primer 1 Sequence
    AATTGCAATTGATATTTACCATAAGA
  • Primer 2 Sequence
    TTCAAAGGAGGTGGGCAG
  • ID
    MGI:706423
  • Product Size
    127
  • Other IDs
    D4Mit229 (BROAD)
  • Note
    MIT assay: MT3489
    Additional information: MIT STS Marker Data Files
Genes
D4Mit229 DNA segment, Chr 4, Massachusetts Institute of Technology 229
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit229 a 134bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
b 136bp CAST/EiJ
c 138bp LP/J
d 142bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D4Mit229 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory