About   Help   FAQ
D9Mit311 Primer Detail
Primers
  • Name
    D9Mit311
  • Primer 1 Sequence
    CAGAAAACACTAATGTTTTGTATCTCA
  • Primer 2 Sequence
    AGAAAACCACCTACCTACCTACACA
  • ID
    MGI:706397
  • Product Size
    140
  • Other IDs
    D9Mit311 (BROAD)
  • Note
    MIT assay: MTH1467
    Additional information: MIT STS Marker Data Files
Genes
D9Mit311 DNA Segment, Chr 9, Massachusetts Institute of Technology 311
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit311 a 124bp A/J, BALB/cJ, C3H/HeJ
b 128bp SPRET/EiJ
c 134bp CAST/EiJ
d 142bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D9Mit311 c 120bp A/JOlaHsd, BALB/cJ, C3H/HeJ
d 138bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
g 104bp 129P3/J
j 126bp JF1
p 114bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory