D9Mit167 Primer Detail MGI Mouse MGI:706388

D9Mit167 Primer Detail

Name

D9Mit167
Primer 1 Sequence

AGGAGGGAGGATAGGATAGGG
Primer 2 Sequence

TCAAATATTATCCCTTTTCCCG
ID

MGI:706388
Product Size

93
Note

MIT assay: MT1755

D9Mit167

DNA segment, Chr 9, Massachusetts Institute of Technology 167

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit167	a	97bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J
	b	99bp	NOD/MrkTac
	c	107bp	CAST/EiJ
	d	109bp	BALB/cJ, NON/ShiLt, SPRET/EiJ
	e	113bp	AKR/J, DBA/2J

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit167	c	upper	CBA/Kw
	D9Mit167	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23