About   Help   FAQ
D3Mit200 Primer Detail
Primers
  • Name
    D3Mit200
  • Primer 1 Sequence
    CAACTTCAGTTTCTCATTTGAATTG
  • Primer 2 Sequence
    GCAAATGGAAGAGGTTTCTCC
  • ID
    MGI:706355
  • Product Size
    133
  • Other IDs
    D3Mit200 (BROAD)
  • Note
    MIT assay: MT2414
    Additional information: MIT STS Marker Data Files
Genes
D3Mit200 DNA segment, Chr 3, Massachusetts Institute of Technology 200
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D3Mit200 a 127bp 129X1/Sv
f 107, 127bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit200 a 99bp CAST/EiJ
b 107bp DBA/2J, NOD/MrkTac
c 115bp AKR/J
d 123bp SPRET/EiJ
e 127bp BALB/cJ, LP/J
f 129bp NON/ShiLt
g 131bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit200 c 148bp CBA/CaOlaHsd
s 151bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory