About   Help   FAQ
D3Mit203 Primer Detail
Primers
  • Name
    D3Mit203
  • Primer 1 Sequence
    CTGAATCCTTATGTCCACTGAGG
  • Primer 2 Sequence
    GGGCACCTGCATTCATGT
  • ID
    MGI:706352
  • Product Size
    150
  • Other IDs
    D3Mit203 (BROAD)
  • Note
    MIT assay: MT3179
    Additional information: MIT STS Marker Data Files
Genes
D3Mit203 DNA segment, Chr 3, Massachusetts Institute of Technology 203
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D3Mit203 a 138bp 129X1/Sv
f 138, 146bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D3Mit203 c 138bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit203 a 124bp SPRET/EiJ
b 138bp A/J, AKR/J, C3H/HeJ
c 146bp LP/J, NON/ShiLt
d 148bp DBA/2J
e 150bp NOD/MrkTac
f 154bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
g 158bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit203 c 143bp CBA/CaOlaHsd
s 148bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory