D3Mit208 Primer Detail MGI Mouse MGI:706347

D3Mit208 Primer Detail

Name

D3Mit208
Primer 1 Sequence

TTCTGGACTAAAGGAGGCACA
Primer 2 Sequence

AGAATTGTGAATGAACAGCGG
ID

MGI:706347
Product Size

147
Other IDs

D3Mit208 (BROAD)
Note

MIT assay: MT3081
Additional information: MIT STS Marker Data Files

D3Mit208

DNA segment, Chr 3, Massachusetts Institute of Technology 208

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit208	a	138bp	DBA/2J, NON/ShiLt
	b	146bp	AKR/J, NOD/MrkTac
	c	150bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J
	d	160bp	CAST/EiJ
	e	166bp	SPRET/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit208	c	upper	CBA/Kw
	D3Mit208	e	lower	KE

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit208	b	lower	C57BL/6J
	D3Mit208	s	upper	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23