About   Help   FAQ
D3Mit208 Primer Detail
Primers
  • Name
    D3Mit208
  • Primer 1 Sequence
    TTCTGGACTAAAGGAGGCACA
  • Primer 2 Sequence
    AGAATTGTGAATGAACAGCGG
  • ID
    MGI:706347
  • Product Size
    147
  • Other IDs
    D3Mit208 (BROAD)
  • Note
    MIT assay: MT3081
    Additional information: MIT STS Marker Data Files
Genes
D3Mit208 DNA segment, Chr 3, Massachusetts Institute of Technology 208
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit208 a 138bp DBA/2J, NON/ShiLt
b 146bp AKR/J, NOD/MrkTac
c 150bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J
d 160bp CAST/EiJ
e 166bp SPRET/EiJ
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D3Mit208 c upper CBA/Kw
e lower KE
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D3Mit208 b lower C57BL/6J
s upper 129/Sv
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory