D6Mit31 Primer Detail MGI Mouse MGI:706339

D6Mit31 Primer Detail

Name

D6Mit31
Primer 1 Sequence

GTAGCAAATTTCAGGACAGCG
Primer 2 Sequence

ACATGGTGTAAACCCTGTTTCC
ID

MGI:706339
Product Size

195
Other IDs

D6Mit31 (BROAD)
Note

MIT assay: A718
Additional information: MIT STS Marker Data Files

D6Mit31

DNA segment, Chr 6, Massachusetts Institute of Technology 31

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit31	c	200bp	C3HeB/FeJLe
	D6Mit31	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit31	a	192bp	CAST/EiJ, NOD/MrkTac
	b	194bp	A/J
	c	196bp	BALB/cJ
	d	198bp	AKR/J, C57BL/6J
	e	200bp	C3H/HeJ, LP/J, NON/ShiLt
	f	202bp	B6.Cg-Lep^ob/+, DBA/2J
	g	230bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit31	c	139bp	CBA/CaOlaHsd
	D6Mit31	s	126bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24