About   Help   FAQ
D6Mit31 Primer Detail
Primers
  • Name
    D6Mit31
  • Primer 1 Sequence
    GTAGCAAATTTCAGGACAGCG
  • Primer 2 Sequence
    ACATGGTGTAAACCCTGTTTCC
  • ID
    MGI:706339
  • Product Size
    195
  • Other IDs
    D6Mit31 (BROAD)
  • Note
    MIT assay: A718
    Additional information: MIT STS Marker Data Files
Genes
D6Mit31 DNA segment, Chr 6, Massachusetts Institute of Technology 31
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D6Mit31 c 200bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit31 a 192bp CAST/EiJ, NOD/MrkTac
b 194bp A/J
c 196bp BALB/cJ
d 198bp AKR/J, C57BL/6J
e 200bp C3H/HeJ, LP/J, NON/ShiLt
f 202bp B6.Cg-Lepob/+, DBA/2J
g 230bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D6Mit31 c 139bp CBA/CaOlaHsd
s 126bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory