About   Help   FAQ
D8Mit46 Primer Detail
Primers
  • Name
    D8Mit46
  • Primer 1 Sequence
    GCCTGGGCTACATGAGACTC
  • Primer 2 Sequence
    GGGAATTCCAATACACTAAAGGG
  • ID
    MGI:706330
  • Product Size
    224
  • Other IDs
    D8Mit46 (BROAD)
  • Note
    MIT assay: B449
    Additional information: MIT STS Marker Data Files
Genes
D9Mit1000 DNA segment, Chr 9, Massachusetts Institute of Technology 1000
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D9Mit1000 a 208bp 129X1/Sv
f 200, 208bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit1000 a 200bp A/J, BALB/cJ, C3H/HeJ
b 208bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
c 212bp NON/ShiLt
d 260bp SPRET/EiJ
e 280bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D9Mit1000 c 196bp A/JOlaHsd, BALB/cJ, C3H/HeJ
d 222bp 129P3/J, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
j 244bp JF1
p 268bp PWB
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory