About   Help   FAQ
D8Mit42 Primer Detail
Primers
  • Name
    D8Mit42
  • Primer 1 Sequence
    ATTATCCCAAGGTGGCCTTC
  • Primer 2 Sequence
    AGGGAACTCACGTTCACACC
  • ID
    MGI:706327
  • Product Size
    149
  • Other IDs
    D8Mit42 (BROAD)
  • Note
    MIT assay: A754
    Additional information: MIT STS Marker Data Files
Genes
D8Mit42 DNA segment, Chr 8, Massachusetts Institute of Technology 42
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D8Mit42 c 144bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit42 a 138bp CAST/EiJ
b 144bp A/J, AKR/J, BALB/cJ, C3H/HeJ
c 148bp LP/J
d 150bp DBA/2J
e 152bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
f 168bp SPRET/EiJ
J:66473 Bagella L, et al., J Cell Biochem. 2000 Apr;78(1):170-8
Endonuclease Gene Allele Fragments Strains
D8Mit42 a 0.144kb AEJ/Gn
s 0.168kb M. spretus
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:66473 Bagella L, et al., Genomic organization, promoter analysis, and chromosomal mapping of the mouse gene encoding Cdk9. J Cell Biochem. 2000 Apr;78(1):170-8
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory