About   Help   FAQ
D8Mit49 Primer Detail
Primers
  • Name
    D8Mit49
  • Primer 1 Sequence
    TCTGTGCATGGCTGTGTATG
  • Primer 2 Sequence
    TGGTGTGCTGCTGATGCT
  • ID
    MGI:706323
  • Product Size
    150
  • Other IDs
    D8Mit49 (BROAD)
  • Note
    MIT assay: B705
    Additional information: MIT STS Marker Data Files
Genes
D8Mit49 DNA segment, Chr 8, Massachusetts Institute of Technology 49
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit49 a 130bp A/J, BALB/cJ
b 152bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
c 154bp AKR/J, C3H/HeJ
d 160bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D8Mit49 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory