About   Help   FAQ
D13Mit235 Primer Detail
Primers
  • Name
    D13Mit235
  • Primer 1 Sequence
    ATGTAGAGAAAGGCCACTGATTG
  • Primer 2 Sequence
    GGGGGGATAGCATTTGAAAT
  • ID
    MGI:706315
  • Product Size
    146
  • Other IDs
    D13Mit235 (BROAD)
  • Note
    MIT assay: MT5051
    Additional information: MIT STS Marker Data Files
Genes
D13Mit235 DNA segment, Chr 13, Massachusetts Institute of Technology 235
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit235 a 137bp CAST/EiJ
b 139bp LP/J
c 140bp A/J, BALB/cJ
d 147bp SPRET/EiJ
e 148bp B6.Cg-Lepob/+
f 149bp C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
g 151bp AKR/J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D13Mit235 c larger CBA/Kw
e smaller KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory