About   Help   FAQ
D9Mit15 Primer Detail
Primers
  • Name
    D9Mit15
  • Primer 1 Sequence
    TTCAGTCCAGTCTGGGGGTA
  • Primer 2 Sequence
    CCCCCAGTTTTGTTGTTTTG
  • ID
    MGI:706313
  • Product Size
    158
  • Note
    MIT assay: M160
Genes
D9Mit15 DNA segment, Chr 9, Massachusetts Institute of Technology 15
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D9Mit15 b not given C57BL/6J
c 155bp C3HeB/FeJLe
f smallest FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D9Mit15 m 155bp MOLF/EiJ
s 200bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit15 a 131bp SPRET/EiJ
b 145bp CAST/EiJ
c 153bp B6.Cg-Lepob/+, C57BL/6J
d 155bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
e 157bp AKR/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory