D15Mit161 Primer Detail MGI Mouse MGI:706303

D15Mit161 Primer Detail

Name

D15Mit161
Primer 1 Sequence

TCTGTTTTGTTTGTTCGTTTGC
Primer 2 Sequence

TAAAATCTCCCTGTATACAAGTCTGTG
ID

MGI:706303
Product Size

99
Other IDs

D15Mit161 (BROAD)
Note

MIT assay: MT2620
Additional information: MIT STS Marker Data Files

DNA segment, Chr 15, Massachusetts Institute of Technology 161

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit161	a	102bp	AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
	b	106bp	A/J, DBA/2J
	c	108bp	B6.Cg-Lep^ob/+
	d	128bp	C57BL/6J, SPRET/EiJ
	e	130bp	NON/ShiLt

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit161	a	smaller	129P3/J
	D15Mit161	s	larger	SJL/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D15Mit161	a	120bp	A.CA/W, BN/aW, C3H/W
	b	94bp	DBA/2W
	c	90bp	BALB/cW, C57BL/6W, C57BL/10W, CBA/W
	d	86bp	129/SvW, AKR/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23