About   Help   FAQ
D15Mit161 Primer Detail
Primers
  • Name
    D15Mit161
  • Primer 1 Sequence
    TCTGTTTTGTTTGTTCGTTTGC
  • Primer 2 Sequence
    TAAAATCTCCCTGTATACAAGTCTGTG
  • ID
    MGI:706303
  • Product Size
    99
  • Other IDs
    D15Mit161 (BROAD)
  • Note
    MIT assay: MT2620
    Additional information: MIT STS Marker Data Files
Genes
D15Mit161 DNA segment, Chr 15, Massachusetts Institute of Technology 161
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit161 a 102bp AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
b 106bp A/J, DBA/2J
c 108bp B6.Cg-Lepob/+
d 128bp C57BL/6J, SPRET/EiJ
e 130bp NON/ShiLt
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D15Mit161 a smaller 129P3/J
s larger SJL/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D15Mit161 a 120bp A.CA/W, BN/aW, C3H/W
b 94bp DBA/2W
c 90bp BALB/cW, C57BL/6W, C57BL/10W, CBA/W
d 86bp 129/SvW, AKR/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory