D12Mit259 Primer Detail MGI Mouse MGI:706296

D12Mit259 Primer Detail

Name

D12Mit259
Primer 1 Sequence

TACCTTGAGAAAAGTATGGAGAAATG
Primer 2 Sequence

TAGCAACATGTAAAAGCATGATACC
ID

MGI:706296
Product Size

124
Other IDs

D12Mit259 (BROAD)
Note

MIT assay: MTH941
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 12, Massachusetts Institute of Technology 259

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit259	a	112bp	A/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	b	114bp	SPRET/EiJ
	c	116bp	CAST/EiJ
	d	122bp	BALB/cJ
	e	126bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D12Mit259	c	121bp	AKR/OlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10, SJL/J
	d	107bp	129P3/J, A/JOlaHsd, C3H/HeJ, DBA/2J, JF1
	p	119bp	PWB

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit259	a	smaller	129P3/J
	D12Mit259	s	larger	SJL/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23