About   Help   FAQ
D5Mit403 Primer Detail
Primers
  • Name
    D5Mit403
  • Primer 1 Sequence
    GGCTCTAGCCATTCCATGTG
  • Primer 2 Sequence
    CTCATGCTCACTCACCTCCA
  • ID
    MGI:706288
  • Product Size
    144
  • Other IDs
    D5Mit403 (BROAD)
  • Note
    MIT assay: MTH2343
    Additional information: MIT STS Marker Data Files
Genes
D5Mit403 DNA Segment, Chr 5 Massachusetts Institute of Technology 403
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit403 a 136bp A/J, BALB/cJ, CAST/EiJ, DBA/2J
b 142bp NON/ShiLt
c 146bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D5Mit403 a 156bp BN/aW
b 146bp 129/SvW, AKR/W, C3H/W, C57BL/6W, C57BL/10W
c 136bp A.CA/W, BALB/cW, CBA/W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory