About   Help   FAQ
D5Mit409 Primer Detail
Primers
  • Name
    D5Mit409
  • Primer 1 Sequence
    GACACAGTTTGGTCACTTGCA
  • Primer 2 Sequence
    ACACACTCTCTCTATTCCACTTTCTG
  • ID
    MGI:706285
  • Product Size
    198
  • Other IDs
    D5Mit409 (BROAD)
  • Note
    MIT assay: MTH1717
    Additional information: MIT STS Marker Data Files
Genes
D5Mit409 DNA Segment, Chr 5 Massachusetts Institute of Technology 409
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit409 a 196bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 192bp 129X1/SvJ
c 196, 202, 214bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit409 a 152bp SPRET/EiJ
b 196bp AKR/J, LP/J
c 198bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
d 214bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, NON/ShiLt
e 242bp CAST/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory