About   Help   FAQ
D13Mit66 Primer Detail
Primers
  • Name
    D13Mit66
  • Primer 1 Sequence
    CTGCCCTGCTTGTTTGGG
  • Primer 2 Sequence
    CCAACTTCAGCCATAAGACAG
  • ID
    MGI:706275
  • Product Size
    150
  • Other IDs
    D13Mit66 (BROAD)
  • Note
    MIT assay: MPC288
    Additional information: MIT STS Marker Data Files
Genes
D13Mit66 DNA segment, Chr 13, Massachusetts Institute of Technology 66
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit66 a 150bp B6.Cg-Lepob/+, C57BL/6J
b 160bp SPRET/EiJ
c 162bp LP/J, NON/ShiLt
d 164bp C3H/HeJ, DBA/2J, NOD/MrkTac
e 168bp A/J, BALB/cJ
f 170bp AKR/J, CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D13Mit66 c 227bp CBA/CaOlaHsd
s 154bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory