D1Mit359 Primer Detail MGI Mouse MGI:706270

D1Mit359 Primer Detail

Name

D1Mit359
Primer 1 Sequence

AGTGGTTCTCTAATGCTATGACCC
Primer 2 Sequence

GAGGAACTGTACACATACATACACACA
ID

MGI:706270
Product Size

116
Other IDs

D1Mit359 (BROAD)
Note

MIT assay: MT4189
Additional information: MIT STS Marker Data Files

D1Mit359

DNA segment, Chr 1, Massachusetts Institute of Technology 359

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit359	a	102bp	AKR/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
	b	110bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	c	118bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	d	128bp	CAST/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit359	c	upper	CBA/Kw
	D1Mit359	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24