About   Help   FAQ
D13Mit77 Primer Detail
Primers
  • Name
    D13Mit77
  • Primer 1 Sequence
    TCTTTGAAGTCCCTTTCAAAGC
  • Primer 2 Sequence
    ATAGCACTGCACTCATGCTCA
  • ID
    MGI:706242
  • Product Size
    275
  • Other IDs
    D13Mit77 (BROAD)
  • Note
    MIT assay: MPC1770
    Additional information: MIT STS Marker Data Files
Genes
D13Mit77 DNA segment, Chr 13, Massachusetts Institute of Technology 77
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit77 m 290bp MOLF/EiJ
s 340bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit77 a 270bp C3H/HeJ, DBA/2J, LP/J, SPRET/EiJ
b 280bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
c 300bp CAST/EiJ
d 310bp NON/ShiLt
e 320bp A/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D13Mit77 a 320bp A.CA/W, BN/aW
b 280bp AKR/W, BALB/cW, C57BL/6W, C57BL/10W, CBA/W
c 270bp 129/SvW, C3H/W, DBA/2W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D13Mit77 c larger CBA/Kw
e smaller KE
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
05/14/2024
MGI 6.23 		The Jackson Laboratory