D8Mit349 Primer Detail MGI Mouse MGI:706226

D8Mit349 Primer Detail

Name

D8Mit349
Primer 1 Sequence

AACCAGAGACAGGGCAAAGA
Primer 2 Sequence

GGTGTATAGGTGACTATGAGGTCTACA
ID

MGI:706226
Product Size

122
Other IDs

D8Mit349 (BROAD)
Note

MIT assay: MTH3177
Additional information: MIT STS Marker Data Files

D8Mit349

DNA segment, Chr 8, Massachusetts Institute of Technology 349

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit349	a	120bp	129X1/Sv
Not Specified	D8Mit349	f	110, 120bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit349	a	108bp	SPRET/EiJ
	b	110bp	NOD/MrkTac
	c	120bp	A/J, AKR/J, C3H/HeJ, LP/J, NON/ShiLt
	d	122bp	B6.Cg-Lep^ob/+, BALB/cJ, DBA/2J
	e	124bp	C57BL/6J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24