About   Help   FAQ
D4Mit37 Primer Detail
Primers
  • Name
    D4Mit37
  • Primer 1 Sequence
    GGAAAGACAAACAGTAGTGTGGG
  • Primer 2 Sequence
    TGCCATAACAACCATGGCTA
  • ID
    MGI:706207
  • Product Size
    236
  • Other IDs
    D4Mit37 (BROAD)
  • Note
    MIT assay: A709
    Additional information: MIT STS Marker Data Files
Genes
D4Mit37 DNA segment, Chr 4, Massachusetts Institute of Technology 37
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D4Mit37 a 236bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 240bp 129X1/SvJ
c 232, 236bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit37 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit37 a 186bp SPRET/EiJ
b 220bp A/J, DBA/2J, NON/ShiLt
c 228bp AKR/J
d 232bp BALB/cJ, C3H/HeJ
e 234bp CAST/EiJ
f 236bp NOD/MrkTac
g 238bp B6.Cg-Lepob/+, C57BL/6J, LP/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit37 c 227bp CBA/CaOlaHsd
s 213bp SWR/OlaHsd
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D4Mit37 c smaller CBA/Kw
e larger KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory