About   Help   FAQ
D7Mit71 Primer Detail
Primers
  • Name
    D7Mit71
  • Primer 1 Sequence
    CCACCTGGAATACATGTAACCC
  • Primer 2 Sequence
    TAAGATCCAAGAGATGGGTTAAGC
  • ID
    MGI:706201
  • Product Size
    117
  • Note
    MIT assay: B621
Genes
D7Mit71 DNA segment, Chr 7, Massachusetts Institute of Technology 71
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit71 a 112bp A/J, NON/ShiLt
b 114bp C3H/HeJ
c 116bp AKR/J, BALB/cJ
d 118bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
e 204bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D7Mit71 a 113bp AKR/OlaHsd
c 105bp BALB/cJ
d 115bp 129P3/J, C57BL/6JOlaHsd, C57BL/10, DBA/2J
h 111bp C3H/HeJ
j 95bp JF1
p 121bp PWB
w 109bp A/JOlaHsd, SJL/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D7Mit71 l larger LG/J
s smaller SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory