About   Help   FAQ
D13Mit139 Primer Detail
Primers
  • Name
    D13Mit139
  • Primer 1 Sequence
    AGAATAAGTCAAGGCTATGATGTGG
  • Primer 2 Sequence
    TTGTTTGTTTGTTTGAAGTAGAACG
  • ID
    MGI:706195
  • Product Size
    139
  • Other IDs
    D13Mit139 (BROAD)
  • Note
    MIT assay: MT1245
    Additional information: MIT STS Marker Data Files
Genes
D13Mit139 DNA segment, Chr 13, Massachusetts Institute of Technology 139
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit139 a 139bp C57BL/6J
b 141bp B6.Cg-Lepob/+
c 145bp A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
d 149bp DBA/2J
e 153bp CAST/EiJ
f 157bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D13Mit139 c 135bp CBA/CaOlaHsd
s 133bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory