D13Mit135 Primer Detail MGI Mouse MGI:706190

D13Mit135 Primer Detail

Name

D13Mit135
Primer 1 Sequence

ACTTTCTTTGGCCCTGGATT
Primer 2 Sequence

CATTCCTGGGTGAGTGTGTG
ID

MGI:706190
Product Size

148
Other IDs

D13Mit135 (BROAD)
Note

MIT assay: MT572
Additional information: MIT STS Marker Data Files

DNA segment, Chr 13, Massachusetts Institute of Technology 135

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit135	a	167bp	129X1/Sv
Not Specified	D13Mit135	f	157, 167bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit135	a	143bp	SPRET/EiJ
	b	145bp	LP/J
	c	149bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	d	157bp	A/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, NOD/MrkTac, NON/ShiLt

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23