D10Mit271 Primer Detail MGI Mouse MGI:706179

D10Mit271 Primer Detail

Name

D10Mit271
Primer 1 Sequence

ACAACCAAAGGTCTTTGTAGAAGA
Primer 2 Sequence

AATATATAGGCACACCTTAATAGCCA
ID

MGI:706179
Product Size

117
Other IDs

D10Mit271 (BROAD)
Note

MIT assay: MTH1299
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 10, Massachusetts Institute of Technology 271

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit271	a	104bp	AKR/J, C3H/HeJ
	b	106bp	LP/J
	c	108bp	SPRET/EiJ
	d	110bp	CAST/EiJ
	e	112bp	A/J, BALB/cJ
	f	116bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D10Mit271	a	102bp	AKR/OlaHsd
	c	110bp	A/JOlaHsd, BALB/cJ
	d	114bp	129P3/J, C57BL/6JOlaHsd, C57BL/10, DBA/2J, PWB
	h	100bp	C3H/HeJ, SJL/J
	j	116bp	JF1

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/18/2025 MGI 6.24