D5Mit25 Primer Detail MGI Mouse MGI:706144

D5Mit25 Primer Detail

Name

D5Mit25
Primer 1 Sequence

AACACACCTCCATACTGGTCG
Primer 2 Sequence

GGCTAACTGAAATTGTTTTGTGC
ID

MGI:706144
Product Size

234
Other IDs

D5Mit25 (BROAD)
Note

MIT assay: B147
Additional information: MIT STS Marker Data Files

D5Mit25

DNA segment, Chr 5, Massachusetts Institute of Technology 25

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D5Mit25	b	larger than f	C57BL/6J
	c	230bp	C3HeB/FeJLe
	f	smaller than c and b	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit25	a	228bp	BALB/cJ
	b	230bp	C3H/HeJ, LP/J
	c	234bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	d	240bp	A/J
	e	244bp	CAST/EiJ, DBA/2J
	f	360bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D5Mit25	a	236bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10
	c	230bp	129P3/J, BALB/cJ, PWB, SJL/J
	d	246bp	DBA/2J
	j	232bp	C3H/HeJ, JF1
	w	244bp	A/JOlaHsd

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit25	l	smaller	LG/J
	D5Mit25	s	larger	SM/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24