About   Help   FAQ
D5Mit25 Primer Detail
Primers
  • Name
    D5Mit25
  • Primer 1 Sequence
    AACACACCTCCATACTGGTCG
  • Primer 2 Sequence
    GGCTAACTGAAATTGTTTTGTGC
  • ID
    MGI:706144
  • Product Size
    234
  • Other IDs
    D5Mit25 (BROAD)
  • Note
    MIT assay: B147
    Additional information: MIT STS Marker Data Files
Genes
D5Mit25 DNA segment, Chr 5, Massachusetts Institute of Technology 25
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D5Mit25 b larger than f C57BL/6J
c 230bp C3HeB/FeJLe
f smaller than c and b FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit25 a 228bp BALB/cJ
b 230bp C3H/HeJ, LP/J
c 234bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
d 240bp A/J
e 244bp CAST/EiJ, DBA/2J
f 360bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D5Mit25 a 236bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10
c 230bp 129P3/J, BALB/cJ, PWB, SJL/J
d 246bp DBA/2J
j 232bp C3H/HeJ, JF1
w 244bp A/JOlaHsd
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D5Mit25 l smaller LG/J
s larger SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory