About   Help   FAQ
D5Mit23 Primer Detail
Primers
  • Name
    D5Mit23
  • Primer 1 Sequence
    GCGGATTTCTGTAAGTTTAAGACT
  • Primer 2 Sequence
    ATGATACCAATATACCCCTTCTCC
  • ID
    MGI:706142
  • Product Size
    194
  • Note
    MIT assay: B362
Genes
D5Mit23 DNA segment, Chr 5, Massachusetts Institute of Technology 23
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit23 a 196bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv, 129X1/Sv
b 192bp 129X1/SvJ
c 180, 196bp CD-1
f 180, 194bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit23 a 180bp C3H/HeJ, NON/ShiLt
b 184bp CAST/EiJ
c 194bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
d 196bp AKR/J, NOD/MrkTac
e 198bp DBA/2J, LP/J
f 208bp SPRET/EiJ
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D5Mit23 c upper CBA/Kw
e lower KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory