About   Help   FAQ
D15Mit5 Primer Detail
Primers
  • Name
    D15Mit5
  • Primer 1 Sequence
    CTTCCTAATTCCTGTCAAGCAAAT
  • Primer 2 Sequence
    GTTTCATTGGTCAATGGAAACTTA
  • ID
    MGI:706113
  • Product Size
    101
  • Other IDs
    D15Mit5 (BROAD)
  • Note
    MIT assay: L1
    Additional information: MIT STS Marker Data Files
Genes
D15Mit5 DNA segment, Chr 15, Massachusetts Institute of Technology 5
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit5 a largest JF1, MSM/Ms
b smaller DBA/2
c smallest C57BL/6
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit5 a 98bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
b 114bp A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac
c 121bp CAST/EiJ, NON/ShiLt
d 127bp LP/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D15Mit5 l smaller LG/J
s larger SM/J
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory