About   Help   FAQ
D15Mit6 Primer Detail
Primers
  • Name
    D15Mit6
  • Primer 1 Sequence
    CCTGGTCTGAAACACTTTTGC
  • Primer 2 Sequence
    CTTGTGAGTGCTCCATGCC
  • ID
    MGI:706112
  • Product Size
    127
  • Other IDs
    D15Mit6 (BROAD)
  • Note
    MIT assay: A59
    Additional information: MIT STS Marker Data Files
Genes
D15Mit6 DNA segment, Chr 15, Massachusetts Institute of Technology 6
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit6 a 102bp CAST/EiJ, LP/J
b 104bp SPRET/EiJ
c 123bp C3H/HeJ
d 126bp NOD/MrkTac, NON/ShiLt
e 128bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
f 130bp A/J
g 132bp DBA/2J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D15Mit6 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory