About   Help   FAQ
D10Mit103 Primer Detail
Primers
  • Name
    D10Mit103
  • Primer 1 Sequence
    TATGCCGACAATATTTCATTGC
  • Primer 2 Sequence
    GCCTCTGCATACATACCAATACC
  • ID
    MGI:706073
  • Product Size
    139
  • Other IDs
    D10Mit103 (BROAD)
  • Note
    MIT assay: MPC2540
    Additional information: MIT STS Marker Data Files
Genes
D10Mit103 DNA segment, Chr 10, Massachusetts Institute of Technology 103
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit103 a 142bp 129X1/Sv
f 142, 146bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Mit103 c 144bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit103 a 126bp CAST/EiJ
b 134bp SPRET/EiJ
c 140bp LP/J
d 142bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac
e 144bp C3H/HeJ, NON/ShiLt
f 146bp A/J, BALB/cJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory