About   Help   FAQ
D15Mit44 Primer Detail
Primers
  • Name
    D15Mit44
  • Primer 1 Sequence
    ACCTGCATAGATGTTGAGTCACA
  • Primer 2 Sequence
    AGGCACAAAAGGAGCAGAGA
  • ID
    MGI:706061
  • Product Size
    164
  • Other IDs
    D15Mit44 (BROAD)
  • Note
    MIT assay: B230
    Additional information: MIT STS Marker Data Files
Genes
D15Mit44 DNA segment, Chr 15, Massachusetts Institute of Technology 44
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit44 b smaller than f C57BL/6J
c 148bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit44 a 118bp CAST/EiJ
b 148bp C3H/HeJ, LP/J, NOD/MrkTac
c 150bp A/J, C57BL/6J, NON/ShiLt
d 152bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, DBA/2J
e 154bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D15Mit44 l larger LG/J
s smaller SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory