About   Help   FAQ
D15Mit42 Primer Detail
Primers
  • Name
    D15Mit42
  • Primer 1 Sequence
    ACCCTGAACCTGACAACTGG
  • Primer 2 Sequence
    TCCTACGGGACAGGAAAGG
  • ID
    MGI:706059
  • Product Size
    162
  • Other IDs
    D15Mit42 (BROAD)
  • Note
    MIT assay: D654
    Additional information: MIT STS Marker Data Files
Genes
D15Mit42 DNA segment, Chr 15, Massachusetts Institute of Technology 42
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit42 c 164bp C3HeB/FeJLe
f larger FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit42 a largest C57BL/6
b smaller JF1, MSM/Ms
c smallest DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit42 a 158bp DBA/2J
b 164bp A/J, C3H/HeJ, LP/J, NON/ShiLt
c 170bp CAST/EiJ
d 184bp NOD/MrkTac
e 188bp AKR/J, BALB/cJ, C57BL/6J
f 192bp B6.Cg-Lepob/+
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D15Mit42 l larger LG/J
s smaller SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory