About   Help   FAQ
D4Mit166 Primer Detail
Primers
  • Name
    D4Mit166
  • Primer 1 Sequence
    AGTTTCCTTTCTCTTCTACTTGTGTG
  • Primer 2 Sequence
    AGGGCATAGGAAACTTTCAGG
  • ID
    MGI:706041
  • Product Size
    199
  • Other IDs
    D4Mit166 (BROAD)
  • Note
    MIT assay: MT1216
    Additional information: MIT STS Marker Data Files
Genes
D4Mit166 DNA segment, Chr 4, Massachusetts Institute of Technology 166
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit166 a 161bp SPRET/EiJ
b 171bp CAST/EiJ
c 175bp LP/J
d 185bp A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
e 197bp AKR/J
f 199bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
g 211bp NON/ShiLt
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit166 c 0.16kb CAST/EiJ
p 0.195kb STOCK Whrnwi
w 0.195kb STOCK Whrnwi
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D4Mit166 a 194bp AKR/OlaHsd, C57BL/10, SJL/J
c 182bp A/JOlaHsd, BALB/cJ, C3H/HeJ
d 196bp C57BL/6JOlaHsd, DBA/2J
g 172bp 129P3/J
p 208bp JF1, PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit166 c 139bp CBA/CaOlaHsd
s 149bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory