D4Mit166 Primer Detail MGI Mouse MGI:706041

D4Mit166 Primer Detail

Name

D4Mit166
Primer 1 Sequence

AGTTTCCTTTCTCTTCTACTTGTGTG
Primer 2 Sequence

AGGGCATAGGAAACTTTCAGG
ID

MGI:706041
Product Size

199
Other IDs

D4Mit166 (BROAD)
Note

MIT assay: MT1216
Additional information: MIT STS Marker Data Files

D4Mit166

DNA segment, Chr 4, Massachusetts Institute of Technology 166

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit166	a	161bp	SPRET/EiJ
	b	171bp	CAST/EiJ
	c	175bp	LP/J
	d	185bp	A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
	e	197bp	AKR/J
	f	199bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	g	211bp	NON/ShiLt

J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9

Gene	Allele	Fragments	Strains
D4Mit166	c	0.16kb	CAST/EiJ
	p	0.195kb	STOCK Whrn^wi
	w	0.195kb	STOCK Whrn^wi

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D4Mit166	a	194bp	AKR/OlaHsd, C57BL/10, SJL/J
	c	182bp	A/JOlaHsd, BALB/cJ, C3H/HeJ
	d	196bp	C57BL/6JOlaHsd, DBA/2J
	g	172bp	129P3/J
	p	208bp	JF1, PWB

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit166	c	139bp	CBA/CaOlaHsd
	D4Mit166	s	149bp	SWR/OlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24